Contact

E-mail:
Andreas Wilm 
GnuPG keyid 0x7C68FBCC
(Fingerprint 12E4 2F6C 43BB 9778 0BEF 75A4 083A 07FA 7C68 FBC)
Phone:
+49 211 8115966
Address:
Institut für Physikalische Biologie
(Department of Physical Biology)
Geb. 26.12.U1
Heinrich-Heine-Universität Düsseldorf
D-40225 Düsseldorf (Germany)

Research Interests

My main research foci are RNA consensus structure prediction and benchmarking of RNA alignment programs.

I'm maintaining ConStruct (we released version 3 - no new publication though). ConStruct combines thermodynamic structure prediction and mutual information statistics in a semiautomatic tool for RNA consensus structure prediction. Its sophisticated GUI allows for an easy alignment correction and its built-in structure prediction routines can predict optimal and suboptimal consensus structures as well as tertiary interactions. See ConStruct's homepage and Presentations below for more information. Find the old homepage here.

My Ph.D. thesis was also concerned with RNA alignment benchmarking. In collaboration with Stefan Washietl and Paul Gardner we carried out and published the first RNA alignment benchmark conducted so far (BRAliBase II; see Paul Gardner's BRAliBase webpage).
A sequel to this benchmark, which includes test-sets with varying number of sequences, parameter optimization of alignment programs and statistical analysis followed in 2006 (see BRAliBase 2.1 webpage).

Publications

Wilm, A. & Mainz, I. & Steger, G. (2006)
An enhanced RNA alignment benchmark for sequence alignment programs.
Algorithms for Molecular Biology 1(19).
(BRAliBase 2.1 webpage)
Deniz D., Wilm, A., Mainz, I. & Steger, G. (2006)
STRAL: Progressive alignment of non-coding RNA using base pairing probability vectors in quadratic time.
Bioinformatics 22, 1593-1599.
(StrAl webserver)
Gardner P.P., Wilm A. & Washietl S. (2005)
A benchmark of multiple sequence alignment programs upon structural RNAs.
Nucleic Acids Research. 33(8), 2433-2439.
Ph.D. Thesis
"RNA-Alignments and RNA-Structure in silico."
Download abstract: english / german
Download full thesis (german).
Master's Thesis / Diploma Thesis
"Optimizing Alignments and Consensus-Structure Predictions."
Download PostScript (german).

Presentations

Source

Debian Packages

Here you'll find some compiled Debian packages. Contact me if you need the corresponding orig.tar.gz, diffs or older versions. You may want to add
deb http://www.biophys.uni-duesseldorf.de/~wilm/deb/ /
to your sources.list.
biosquid
Squid is Sean Eddy's personal library of C functions and utility programs for sequence analysis. I had to call the package biosquid to avoid name clash with the proxy named squid.
vienna-rna
Vienna RNA Secondary Structure Package
rna-forester
RNAforester: structural motif detection in RNA secondary structures based on local RNA structure alignments (as of version 1.6 part of vienna-rna!)

Misc Sources

squicl
I really like Tcl/Tk but it lacks a BioPerl counterpart. That's why I created squicl, which provides an Tcl-interface to the Vienna RNA package (RNAfold etc.) and Squid routines. A command reference is currently missing, but example scripts are included. This version is known to work with vienna-rna 1.5b and squid 1.9g (local copies).
maxbpmatch
During my Bioinformatics teaching courses I implemented Nussinov's algorithm for RNA folding via basepair maximization (dynamic programming) in several languages.
The C-source includes generic routines for handling stacks and matrices, including dotplots.
Compare this to the Perl version (html) and to the Tcl version (html).
A Bash version is still under construction ;).

Some test sets:

tRNA with bottom bulge
caaaacccucuaacccuuuucccaauu
.((((...).)((...))((...))))

tRNA with internal loop
caaacacccucuaacccuuuucccaauu
.(((.(...).)((...))((...))))

tRNA with top bulge
caaacacccuuaacccuuuucccaauu
.(((.(...))((...))((...))))

tRNA with top bulge and unpaired nt in bifurcation
caacacacccuucaacccuucuucccaacuu
.((.(.(...)).((...)).((...)).))

Exits